Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
rno circ 0005854 | |||
Gene | n/a | Organism | Rat |
Genome Locus | n/a | Build | n/a |
Disease | Neuropathy | ICD-10 | Hereditary and idiopathic neuropathy (G60) |
DBLink | Link to database | PMID | 28420964 |
Experimental Method | |||
Sample Type | Tissues | Comparison | 12 rats for SNI and sham operation. At 14 days after operation, three rats were randomly selected in each group and deeply anesthetized with isoflurane after the behavioral test. |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TGCAGAGGAACTGAGTATGG ReverseCAGGGACTCTGTCCCCTTTC | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Zhou, J, Xiong, Q, Chen, H, Yang, C, Fan, Y (2017). Identification of the Spinal Expression Profile of Non-coding RNAs Involved in Neuropathic Pain Following Spared Nerve Injury by Sequence Analysis. Front Mol Neurosci, 10:91. |